Download TRANSFORMATION OF FINGER MILLET PDF

TitleTRANSFORMATION OF FINGER MILLET
LanguageEnglish
File Size2.8 MB
Total Pages96
Document Text Contents
Page 1

“IN VITRO REGENERATION AND GENETIC

TRANSFORMATION OF FINGER MILLET

(Eleucine coracana L.) GENOTYPE GN-4”


A

THESIS

SUBMITTED TO THE

NAVSARI AGRICULTURAL UNIVERSITY

NAVSARI



IN PARTIAL FULFILMENT OF THE REQUIREMENTS

FOR

THE AWARD OF THE DEGREE



OF



MASTERS OF SCIENCE

IN

PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY













BY

DABHI KIRTI ARAJANBHAI
B.Sc. (Biotechnology)




DEPARTMENT OF BIOTECHNOLOGY

N.M.COLLEGE OF AGRICULTURE

NAVSARI AGRICULTURAL UNIVERSITY

NAVSARI- 396 450

GUJARAT

November-2015

Registration No. 04-0955-2011

Page 48

(0.1 M Tris, pH 8.0; 0.05 M EDTA, pH 8.0; 1.5 M NaCl; 0.01 M

β-mercaptoethanol, CTAB 3%, PVP 1%) was added.

3. Mixture were homogenized properly and incubated at 65
0
C for 40-

45 mins.

4. Equal volume of Chloroform: Isoamyl alcohol (24:1) was added,

mixed by mild vortexing for 5-10 seconds and centrifuged at

13,000 rpm for 5 minutes at room temperature.

5. Upper phase was collected and double volume of isopropanol was

added, gently invert the tubes and keep at -20
0
C for 2-3 hour.

6. After this DNA was pelleted by centrifugation at 13,000 rpm for 20

minutes at 4
0
C.

7. The pellet was washed with 70 % ethanol, centrifuge at 13,000

rpm for 20 minutes at 4
0
C.

8. Pellet was dried in dry bath at 65
0
C

9. 50µl TE buffer was added in pellet, spin it for proper mixing

3.5.2.1b Isolation of plasmid DNA

Plasmid DNA was isolated by standard alkaline lysis method

(Sambrook et al., 1989). Isolated DNA was given RNAse treatment and

purified with phenol: chloroform method.

3.5.2.2 Estimation of quantity and quality of DNA

The quantification of DNA was carried out as per using Nanodrop

spectrophotometer and O.D was measured at 260 and 280 nm. The

quality of DNA was checked on 0.8 % (w/v) agarose gel prepared in 0.5X

TBE (Tris 45 mM, Boric Acid 45 mM and EDTA 1 mM ) containing 5 µl

of ethidium bromide (EtBr 50g/ml) per 100 ml of buffer. The already

extracted genomic DNA from the stock (5 µl) was mixed with 1 µl of 6X

agarose gel loading dye. The 5µl sample was loaded in each well using

micropippette. Gel was provided a potential difference of 5-6 V/cm for an

hour. Bands were visualized under UV light using a transilluminator.

31

Page 49

The samples, which resolved into a single discrete high molecular

weight band near the well with no shearing, were considered to be of

good quality. The good quality DNA samples with a ratio of 1.8 – 2.0 at

O.D. 260/280 were retained for PCR amplification. The stocks were

diluted to a final concentration of 50 ng/µl of DNA and used for further

applications.

3.6 Polymerase Chain Reaction (PCR):

Genomic DNA isolated from leaves of plants by the CTAB method

with minor modification (Doyle and Doyle, 1990). PCR amplification of

a 1.0 kb DNA fragment of gene was carried out in Biometra thermal

cycler using the hpt II gene fragment was amplified using the forward

primer 5’ CCCTGATGGCATCCGAAGAGC 3’ and the reverse primer

5’ GAGGCAGCAGTGATGACATCC 3’. The PCR reaction mixture

contain 50 ng genomic DNA in a final volume of 20 µl containing 1x

PCR buffer, 1.2 µl MgCl2, 250 µM dNTPs, 1 µl each of primer and 0.3

units of Taq DNA polymerase. Amplification was carried out by:-

Step-I: Initial denaturation at 94
0
C for 4 minutes

Step-II: followed by 30 amplification cycle at 94
0
C for 50 seconds

Step-III: Final extension at 72
0
C carried for 5 minutes.

The completed reactions were then held at 4
0
C until

electrophoresis was done. PCR products were separated by loading 1.5

µL of each sample and 2 µl of loading buffer type II on a 1.2 % agarose

gel prepared with 0.5X TBE buffer. The sample were subject to

electrophoresis at 80-90V for 20-25 minutes in 0.5X TBE buffer. The gel

was stained with ethidium bromide and visualized under UV light.

3.7 Total RNA Isolation

Total RNA was extracted from the leaves by a modified Trizol

method. Fresh leaves (0.1 g) from plant were powdered in liquid nitrogen

using a pestle and mortar.

32

Similer Documents